Replication and Translation Paper.

Please make sure you read it all thoroughly. Some instructions and assumptions have changed. You need to work through this carefully. Show all of your work. (20 points) DNA Replication. Below is a section of single-stranded DNA that was just isolated from a population of bacteria just found on Mars. We will call this the normal allele or wild-type allele. 5’– TTGCCCAAATGTATACCATCATGGAATTTCTTATAGAGTCATTCGCATCGACATAACACAGCTT GAGCTGCAGGCCATACTACCGTAAGAT–3’ 1.

ORDER CUSTOM, PLAGIARISM-FREE PAPER

If this piece of DNA were to be a template during DNA replication, what would the resulting double-stranded DNA look like? Assume that everything works on Mars just like on Earth unless you are told differently. Replicate it properly and show all important components of both DNA strands. Type it out so you do not make a mistake and I can read it. 2. At the 3’ end of all DNA and RNA there is a functional chemical group. What is its significance to DNA replication? 3. In a cell, many enzymes work in an ordered way to make DNA replication possible. One enzyme in particular would be needed to replicate this piece of DNA in the cell. It is the same process that is provided by a researcher supplying primers when PCR is performed. What is the enzyme? Explain the role of the enzyme in the cell and how it does its job. 4. One allele of DNA that is found in the population has the AC nucleotides (bold above) mutated to GA. Type the double-strand piece of DNA that would be responsible for this allele.

Type it out so you do not make a mistake and I can read it. We will call this allele AC to GA allele. 5. A third allele that is found in the population has the single C nucleotide (underlined above) deleted. It is totally missing, but all of the rest of the DNA is present. Type the double-strand piece of DNA that would be responsible for this allele. Type it out so you do not make a mistake and I can read it. We will call this allele C allele. Transcription. You will be working with all three of the different alleles that you created above; wild-type (normal), AC to GA, and C. All three alleles use the top DNA strand as their coding strand. There is no promoter, so just start transcribing from the beginning of the correct strand. Type the RNA that results with the 5’ at the left of the paper. Replication and Translation Paper.

6. Provide the primary transcript that results from the wild-type allele. Type it out so you do not make a mistake and I can read it. 7. Provide the primary transcript that results from the AC to GA allele. Type it out so you do not make a mistake and I can read it. 8. Provide the primary transcript that results from the C allele. Type it out so you do not make a mistake and I can read it. 9. What enzyme is responsible for creating these primary transcripts? Briefly describe how this enzyme works in the cell. 10. In question #3 above there is a requirement for a functional chemical group at the 3’ to initiate DNA Replication. Does initiation of transcription require the same functional chemical group for RNA Replication? Explain. mRNA Processing.

You will be working with all three of the primary transcripts that you created above; wild-type (normal), AC to GA, and C. Splicing of the primary transcript is one modification required to make mature mRNA in eukaryotes. Type the mRNA that results with the 5’ at the left of the paper. On Mars, Splicing enzymes recognize the 5’ end of introns that have the following sequence: UUU|CUU where the bold letters are the exon and the regular letters are intron. Splicing enzymes recognize the 3’ end of introns that have the following sequence: UUC|GCA where the bold letters are the exon portion and the regular letters are intron. The | is used to show the separation of the exon and the intron at both ends of the intron. Exons are bold, introns are not. 11. Provide the mature mRNA that results from the primary transcript of the wild-type allele when it undergoes splicing. Replication and Translation Paper.

Type it out so you do not make a mistake and I can read it. 12. Provide the mature mRNA that results from the primary transcript of the AC to GA allele when it undergoes splicing. Type it out so you do not make a mistake and I can read it. 13. Provide the mature mRNA that results from the primary transcript of the C allele when it undergoes splicing. Type it out so you do not make a mistake and I can read it. 14. Splicing is one modification that occurs to a primary transcript. Name and describe one other process that happens to primary transcripts to make them mature mRNAs. 15. Splicing and what you wrote in #14 above are two modifications that occur to a primary transcript. Name and describe one other process that happens to primary transcripts to make them mature mRNAs. Translation. You will be working with all three of the mature mRNA transcripts that you created above; wildtype (normal), AC to GA, and C. Type the polypeptide that results with the amino terminus at the left of the paper. 16. Provide the polypeptide that results from the mature mRNA of the wild-type allele.

Type it out so you do not make a mistake and I can read it. 17. Provide the polypeptide that results from the mature mRNA of the AC to GA allele. Type it out so you do not make a mistake and I can read it. 18. Provide the polypeptide that results from the mature mRNA of the C allele. Type it out so you do not make a mistake and I can read it. 19. What functional chemical group is always found at the right of a polypeptide when written on this paper? What is its importance to the polypeptide? 20. Look at all three polypeptide chains. There should be some differences if you did this assignment correctly. You might find it helpful to use the one letter amino acid code if you have not already done so. Reflect on the importance of all of the enzymes used from DNA through Protein to work with high-fidelity (they do their job correctly without making mistakes).

You must proofread your paper. But do not strictly rely on your computer’s spell-checker and grammar-checker; failure to do so indicates a lack of effort on your part and you can expect your grade to suffer accordingly. Papers with numerous misspelled words and grammatical mistakes will be penalized. Read over your paper – in silence and then aloud – before handing it in and make corrections as necessary. Often it is advantageous to have a friend proofread your paper for obvious errors. Handwritten corrections are preferable to uncorrected mistakes.

Use a standard 10 to 12 point (10 to 12 characters per inch) typeface. Smaller or compressed type and papers with small margins or single-spacing are hard to read. It is better to let your essay run over the recommended number of pages than to try to compress it into fewer pages.

Likewise, large type, large margins, large indentations, triple-spacing, increased leading (space between lines), increased kerning (space between letters), and any other such attempts at “padding” to increase the length of a paper are unacceptable, wasteful of trees, and will not fool your professor.

The paper must be neatly formatted, double-spaced with a one-inch margin on the top, bottom, and sides of each page. When submitting hard copy, be sure to use white paper and print out using dark ink. If it is hard to read your essay, it will also be hard to follow your argument.

ADDITIONAL INSTRUCTIONS FOR THE CLASS

Discussion Questions (DQ)

Initial responses to the DQ should address all components of the questions asked, include a minimum of one scholarly source, and be at least 250 words.
Successful responses are substantive (i.e., add something new to the discussion, engage others in the discussion, well-developed idea) and include at least one scholarly source.
One or two sentence responses, simple statements of agreement or “good post,” and responses that are off-topic will not count as substantive. Substantive responses should be at least 150 words.
I encourage you to incorporate the readings from the week (as applicable) into your responses.

Weekly Participation

Your initial responses to the mandatory DQ do not count toward participation and are graded separately.
In addition to the DQ responses, you must post at least one reply to peers (or me) on three separate days, for a total of three replies.
Participation posts do not require a scholarly source/citation (unless you cite someone else’s work).
Part of your weekly participation includes viewing the weekly announcement and attesting to watching it in the comments. These announcements are made to ensure you understand everything that is due during the week.

APA Format and Writing Quality

Familiarize yourself with APA format and practice using it correctly. It is used for most writing assignments for your degree. Visit the Writing Center in the Student Success Center, under the Resources tab in LoudCloud for APA paper templates, citation examples, tips, etc. Points will be deducted for poor use of APA format or absence of APA format (if required).
Cite all sources of information! When in doubt, cite the source. Paraphrasing also requires a citation.
I highly recommend using the APA Publication Manual, 6th edition.

Use of Direct Quotes

I discourage overutilization of direct quotes in DQs and assignments at the Masters’ level and deduct points accordingly.
As Masters’ level students, it is important that you be able to critically analyze and interpret information from journal articles and other resources. Simply restating someone else’s words does not demonstrate an understanding of the content or critical analysis of the content.
It is best to paraphrase content and cite your source.

LopesWrite Policy

For assignments that need to be submitted to LopesWrite, please be sure you have received your report and Similarity Index (SI) percentage BEFORE you do a “final submit” to me.
Once you have received your report, please review it. This report will show you grammatical, punctuation, and spelling errors that can easily be fixed. Take the extra few minutes to review instead of getting counted off for these mistakes.
Review your similarities. Did you forget to cite something? Did you not paraphrase well enough? Is your paper made up of someone else’s thoughts more than your own?
Visit the Writing Center in the Student Success Center, under the Resources tab in LoudCloud for tips on improving your paper and SI score.

Late Policy

The university’s policy on late assignments is 10% penalty PER DAY LATE. This also applies to late DQ replies.
Please communicate with me if you anticipate having to submit an assignment late. I am happy to be flexible, with advance notice. We may be able to work out an extension based on extenuating circumstances.
If you do not communicate with me before submitting an assignment late, the GCU late policy will be in effect.
I do not accept assignments that are two or more weeks late unless we have worked out an extension.
As per policy, no assignments are accepted after the last day of class. Any assignment submitted after midnight on the last day of class will not be accepted for grading.

Communication

Communication is so very important. There are multiple ways to communicate with me:
Questions to Instructor Forum: This is a great place to ask course content or assignment questions. If you have a question, there is a good chance one of your peers does as well. This is a public forum for the class.
Individual Forum: This is a private forum to ask me questions or send me messages. This will be checked at least once every 24 hours.

Replication and Translation Paper.

Replication and Translation Paper.